concatenate fasta file

Discussion in 'Python' started by PeroMHC, Feb 12, 2010.

  1. PeroMHC

    PeroMHC Guest

    Hi All, I have a simple problem that I hope somebody can help with. I
    have an input file (a fasta file) that I need to edit..

    Input file format

    >name 1

    >name 2

    >name 3


    I need to concatenate the sequences.. make them look like



    thanks. Matt
    PeroMHC, Feb 12, 2010
    1. Advertisements

  2. PeroMHC

    Roy Smith Guest

    In article
    PeroMHC <> wrote:

    > Hi All, I have a simple problem that I hope somebody can help with. I
    > have an input file (a fasta file) that I need to edit..
    > Input file format
    > >name 1

    > tactcatacatac
    > >name 2

    > acggtggcat
    > >name 3

    > gggtaccacgtt
    > I need to concatenate the sequences.. make them look like
    > >concatenated

    > tactcatacatacacggtggcatgggtaccacgtt
    > thanks. Matt

    Some quick ideas. First, try something along the lines of (not tested):

    for line in sys.stdin:
    if line.startswith('>'):
    print ''.join(data)

    Second, check out I'm sure somebody
    has solved this problem before.
    Roy Smith, Feb 12, 2010
    1. Advertisements

  3. PeroMHC wrote:
    > Hi All, I have a simple problem that I hope somebody can help with. I
    > have an input file (a fasta file) that I need to edit..
    > Input file format
    >> name 1

    > tactcatacatac
    >> name 2

    > acggtggcat
    >> name 3

    > gggtaccacgtt
    > I need to concatenate the sequences.. make them look like
    >> concatenated

    > tactcatacatacacggtggcatgggtaccacgtt
    > thanks. Matt

    A solution using regexp:

    found = []
    for line in open('seqfile.txt'):
    found += re.findall('^[acgtACGT]+$', line)

    print found
    > ['tactcatacatac', 'acggtggcat', 'gggtaccacgtt']

    print ''.join(found)
    > 'tactcatacatacacggtggcatgggtaccacgtt'

    Jean-Michel Pichavant, Feb 12, 2010
  4. On 2010-02-12, PeroMHC <> wrote:
    > Hi All, I have a simple problem that I hope somebody can help with. I
    > have an input file (a fasta file) that I need to edit..
    > Input file format
    >>name 1

    > tactcatacatac
    >>name 2

    > acggtggcat
    >>name 3

    > gggtaccacgtt
    > I need to concatenate the sequences.. make them look like

    > tactcatacatacacggtggcatgggtaccacgtt

    (echo "concantenated>"; grep '^ [actg]*$' inputfile | tr -d '\n'; echo) > outputfile

    Grant Edwards, Feb 13, 2010
    1. Advertisements

Want to reply to this thread or ask your own question?

It takes just 2 minutes to sign up (and it's free!). Just click the sign up button to choose a username and then you can ask your own questions on the forum.
Similar Threads
  1. Chris Lasher
    Bengt Richter
    Jan 16, 2005
  2. idiotprogrammer
    Joseph Kesselman
    Mar 5, 2007
  3. kgk
    Marc 'BlackJack' Rintsch
    Jul 11, 2007
  4. Replies:
    Anno Siegel
    Mar 1, 2006
  5. Carlos


    Carlos, Oct 12, 2012, in forum: VHDL

Share This Page