P
PeroMHC
Hi All, I have a simple problem that I hope somebody can help with. I
have an input file (a fasta file) that I need to edit..
Input file format
I need to concatenate the sequences.. make them look like
thanks. Matt
have an input file (a fasta file) that I need to edit..
Input file format
gggtaccacgttname 1 tactcatacatac
name 2 acggtggcat
name 3
I need to concatenate the sequences.. make them look like
tactcatacatacacggtggcatgggtaccacgttconcatenated
thanks. Matt