Hello everyone, I would need help in bioinfo please.

[Bl4ckouts]

Hi, I am turning to this community as I start getting desperate on my project... I am trying to detect viruses in my samples. For that, I have extracted RNA, sequenced them and now, the fun but hard part ( for me ): command lines on linux.
I know what to use ( hmmer, checkV, Vir Sorter, BLAST) but I have no idea how to run them or what to do with them. I feel completely lost.

Also, I managed to filter my samples on linux and I need to: select the samples with low reads, classify them in order and make an histogram from it to detect a potential pattern with existing viruses. Do you know the command line on linux ? Many thanks

 

[Sdfgbdfbhdfhfg54yeh]

Since this is programming forum not biology forum I like others here, likely have little knowledge of these commands gave...

HMMR seems to use Markov to classify the data, something like spam filter.

Here's a user guide http://eddylab.org/software/hmmer/Userguide.pdf
Starting page 17 how to install... for the command line you type something like:

./configure --prefix=path_to_install_to
make
sudo make install

or a pre-compiled version depending on which OS you have:

apt install hmmer

And a tutorial page 27

cd tutorial
hmmbuild globins4.hmm globins4.sto
hmmsearch globins4.hmm globins45.fa

 

[Bl4ckouts]

Since this is programming forum not biology forum I like others here, likely have little knowledge of these commands gave...

HMMR seems to use Markov to classify the data, something like spam filter.

Here's a user guide http://eddylab.org/software/hmmer/Userguide.pdf
Starting page 17 how to install... for the command line you type something like:

./configure --prefix=path_to_install_to
make
sudo make install

or a pre-compiled version depending on which OS you have:

apt install hmmer

And a tutorial page 27

cd tutorial
hmmbuild globins4.hmm globins4.sto
hmmsearch globins4.hmm globins45.fa

Thank you for your help, I will check this out right now. Much appreciated

 

[Bl4ckouts]

Since this is programming forum not biology forum I like others here, likely have little knowledge of these commands gave...

HMMR seems to use Markov to classify the data, something like spam filter.

Here's a user guide http://eddylab.org/software/hmmer/Userguide.pdf
Starting page 17 how to install... for the command line you type something like:

./configure --prefix=path_to_install_to
make
sudo make install

or a pre-compiled version depending on which OS you have:

apt install hmmer

And a tutorial page 27

cd tutorial
hmmbuild globins4.hmm globins4.sto
hmmsearch globins4.hmm globins45.fa

Hello again,
I may need your help for this task as it seems simple but I get confused when it involved loads of samples.
I need to classify ''reads'' by length and then plot the result.
''Reads'' are a sequence of letters but they have a name including the number of the read, the lengh and some other details. ( see below):

NODE_1_length_14895_cov_175.056942_g0_i0

CACCGGCAGCGCTGACGTCACAATGGGGCGCTGGCTGGCCGGTAAGCTGATGAAGGAGCT
GGGTATCGCCCGTTGCCAGCTACCGGCTCACAAATACAACCGCGGTGGCAATGAACACAT
TGAAATACCGAATCATCTCAACCGCCAGTTCGCGGTGACCGCGTCGGATCAGGTCTGGTG
TCATGGTAATATCTA

NODE_2_length_13980_cov_67.692313_g1_i0

CGACAAATGGTTACAACAGCTTCAGCGAAGCCATGGCCGCGATCATCCGCTACATCACCG
GGTATTACAGCGGTATCCGGCCTCACTGGTATAACGGTGGCTTAACTCCAAACGAATCTG
.
.
.

etc ( about a thousand of samples ( NODE_144506))

The other question is: is it possible to see a representation of the plot on linux? I am used to R but a newbie on linux.

Many thanks