Problems reading from files

L

lancer6238

Hi all,
I'm having programs reading from files.

I have a text file "files.txt" that contains the names of the files to
be opened, i.e. the contents of files.txt are

Homo_sapiens.fa
Rattus_norvegicus.fa

(They are FA files that can be opened in any text editor.)

Each of the FA files contains a number in the first line and a string
of characters (A,T,G or C). For example, the Homo_sapiens.fa file
would contain

16571
GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTT
CGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTC
GCAGTATCTGTCTTTGATTCCTGCCTCATTCTATTATTTATCGCACCTACGTTCAATATT
ACAGGCGAACATACCTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATA

and so on, with 16571 A,T,G or Cs.

Below is my code:

#include <stdio.h>
#include <stdlib.h>

#define MAX_FILE 100 // maximum length of file name
#define MAX_SEQ 20000 // maximum length of sequence
#define N 2 // total number of sequences

int main(void)
{
FILE *fin, *fin1, *fout;
char input[MAX_FILE+1], seq[N][MAX_SEQ+1], c;
int size[N], i = 0, j = 0;

fin = fopen("files.txt", "r");
fout = fopen("output.txt", "w");
while (fscanf(fin, "%s", input) != EOF)
{
fin1 = fopen(input, "r");
printf("%s\n", input);
fscanf(fin1, "%d ", &size);
printf("%d\n", size);
while ((c = fgetc(fin1)) != EOF)
{
fprintf(fout, "%c", c);
if (c != '\n')
seq[j] = c;
j++;
if (j % 100 == 0)
printf("%c", seq[j]);
}
fprintf(fout, "\n\n");
j = 0;
i++;
}

fclose(fin);
fclose(fin1);
fclose(fout);
return 0;
}

The printf statements for me to check my code.

When I try to open 2 files, the first file is read in fine, but the
second file is incomplete. Over 600 characters are not read, and the
program hangs.

I get the output (due to the checking printf statements)

Homo_sapiens.fa
16571
Rattus_norvegicus.fa
16300
<program hangs>

Notice that the statements
if (j % 100 == 0)
printf("%c", seq[j]);
are not executed, but if I just print the character seq[0][100], it
comes out correctly.

If I try to open 3 files, the same program happens, i.e. the first
file is read correctly, but the second file is incomplete and the
third file is not read at all. I get the output

Homo_sapiens.fa
16571
Rattus_norvegicus.fa
16300
Homo_sapiens.fa
16571
Segmentation fault

I tried my program with 2 much smaller files (one has 13 characters
and the other 14), and the program works. Are the 2 files too big and
the program ran out of memory? How do I get around this problem, as I
have to read files even bigger than these 2 later?

Thank you.

Regards,
Rayne
 
M

Malcolm McLean

Hi all,
I'm having programs reading from files.

I have a text file "files.txt" that contains the names of the files to
be opened, i.e. the contents of files.txt are

Homo_sapiens.fa
Rattus_norvegicus.fa

(They are FA files that can be opened in any text editor.)

Each of the FA files contains a number in the first line and a string
of characters (A,T,G or C). For example, the Homo_sapiens.fa file
would contain

16571
GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTT
CGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTC
GCAGTATCTGTCTTTGATTCCTGCCTCATTCTATTATTTATCGCACCTACGTTCAATATT
ACAGGCGAACATACCTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATA

and so on, with 16571 A,T,G or Cs.

Below is my code:

#include <stdio.h>
#include <stdlib.h>

#define MAX_FILE 100 // maximum length of file name
#define MAX_SEQ 20000 // maximum length of sequence
#define N 2 // total number of sequences

int main(void)
{
FILE *fin, *fin1, *fout;
char input[MAX_FILE+1], seq[N][MAX_SEQ+1], c;
Thjis line could cause problems, seq is too big to so safely on the stack.
make it static.
int size[N], i = 0, j = 0;

fin = fopen("files.txt", "r");
fout = fopen("output.txt", "w");
Check here .
if(!fin) /* haven't opened fin */
if(|fout) /* haven't opened fout */
while (fscanf(fin, "%s", input) != EOF)
{
fin1 = fopen(input, "r");
Check here
if (!fin1); /* can't open fin 1 */
printf("%s\n", input);
Is this diagnostic doing what you expect. I suspect you don't want fscanf(),
you wnat fgets() to read a whole line, then chop of the trailing newline.
fscanf(fin1, "%d ", &size);
printf("%d\n", size);
while ((c = fgetc(fin1)) != EOF)
{
fprintf(fout, "%c", c);
if (c != '\n')
seq[j] = c;
j++;
if (j % 100 == 0)
printf("%c", seq[j]);

Check here if(j >= MAX_SEQ -1) /* j too big, out of space */
Put a null on the end for convenience, hence the minus 1.
}
fprintf(fout, "\n\n");
j = 0;
i++;
What happens when i goes greater than 1 ? You will do an illegal meory
access. You need to check if( i >= N) /* can't continue, out of space */
}

fclose(fin);
fclose(fin1);
fclose(fout);
return 0;
}

The printf statements for me to check my code.

When I try to open 2 files, the first file is read in fine, but the
second file is incomplete. Over 600 characters are not read, and the
program hangs.

I get the output (due to the checking printf statements)

Homo_sapiens.fa
16571
Rattus_norvegicus.fa
16300
<program hangs>

Notice that the statements
if (j % 100 == 0)
printf("%c", seq[j]);
are not executed, but if I just print the character seq[0][100], it
comes out correctly.

If I try to open 3 files, the same program happens, i.e. the first
file is read correctly, but the second file is incomplete and the
third file is not read at all. I get the output

Homo_sapiens.fa
16571
Rattus_norvegicus.fa
16300
Homo_sapiens.fa
16571
Segmentation fault

I tried my program with 2 much smaller files (one has 13 characters
and the other 14), and the program works. Are the 2 files too big and
the program ran out of memory? How do I get around this problem, as I
have to read files even bigger than these 2 later?

Thank you.

Regards,
Rayne
 
A

Army1987

Hi all,
I'm having programs reading from files.

I have a text file "files.txt" that contains the names of the files to
be opened, i.e. the contents of files.txt are

Homo_sapiens.fa
Rattus_norvegicus.fa

(They are FA files that can be opened in any text editor.)
Each of the FA files contains a number in the first line and a string
of characters (A,T,G or C). For example, the Homo_sapiens.fa file
would contain

16571
GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTT
CGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTC
GCAGTATCTGTCTTTGATTCCTGCCTCATTCTATTATTTATCGCACCTACGTTCAATATT
ACAGGCGAACATACCTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATA

and so on, with 16571 A,T,G or Cs.

Below is my code:

#include <stdio.h>
#include <stdlib.h>

#define MAX_FILE 100 // maximum length of file name
stdio.h contains a macro FILENAME_MAX for that purpose.
It already includes room for the terminating null.
#define MAX_SEQ 20000 // maximum length of sequence
#define N 2 // total number of sequences

int main(void)
{
FILE *fin, *fin1, *fout;
char input[MAX_FILE+1], seq[N][MAX_SEQ+1], c;
Try making them static, 40 KB of auto variables could be too much.
int size[N], i = 0, j = 0;

fin = fopen("files.txt", "r");
fout = fopen("output.txt", "w");
You should check whether those work, and cope with that otherwise.
while (fscanf(fin, "%s", input) != EOF)
%s will stop on any whitespace character, not just newlines. Is
that ok? (BTW, what happens if files.txt contains a name which is
too long?)
{
fin1 = fopen(input, "r");
printf("%s\n", input);
fscanf(fin1, "%d ", &size);
printf("%d\n", size);
while ((c = fgetc(fin1)) != EOF)

c is declared as a char. If it is unsigned it will never equal
EOF. If it is signed, some valid character (though none of 'ACGT')
could be mistaken as EOF. fgetc returns an int. See www.c-faq.com,
section 12, question 1.
{
fprintf(fout, "%c", c);
if (c != '\n')
seq[j] = c;
j++;

Note that j will be incremented even if c is '\n', in
this case there will be a gap in the sequence. Add braces where
needed.
if (j % 100 == 0)
printf("%c", seq[j]);

You're already incremented j, so seq[j] will be uninitialized
at this time. For example, if at the beginning of the loop body
j were 99 and c were 'T' you would write c into seq[99],
increment j to 100, and print seq[100].
}
fprintf(fout, "\n\n");
j = 0;
i++;
}

fclose(fin);
fclose(fin1);
fclose(fout);
Ideally you should check whether the fclose() worked without
problems.
 
C

CBFalconer

I'm having programs reading from files.

I have a text file "files.txt" that contains the names of the files to
be opened, i.e. the contents of files.txt are

Homo_sapiens.fa
Rattus_norvegicus.fa

(They are FA files that can be opened in any text editor.)

Each of the FA files contains a number in the first line and a string
of characters (A,T,G or C). For example, the Homo_sapiens.fa file
would contain

16571
GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTT
CGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTC
GCAGTATCTGTCTTTGATTCCTGCCTCATTCTATTATTTATCGCACCTACGTTCAATATT
ACAGGCGAACATACCTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATA

and so on, with 16571 A,T,G or Cs.

Below is my code:

#include <stdio.h>
#include <stdlib.h>

#define MAX_FILE 100 // maximum length of file name
#define MAX_SEQ 20000 // maximum length of sequence
#define N 2 // total number of sequences

int main(void)
{
FILE *fin, *fin1, *fout;
char input[MAX_FILE+1], seq[N][MAX_SEQ+1], c;
int size[N], i = 0, j = 0;

fin = fopen("files.txt", "r");
fout = fopen("output.txt", "w");

You fail to check for success of the fopen calls.
while (fscanf(fin, "%s", input) != EOF) {
fin1 = fopen(input, "r");
printf("%s\n", input);
fscanf(fin1, "%d ", &size);


You fail to check for success of the fscanf call.
printf("%d\n", size);
while ((c = fgetc(fin1)) != EOF) {


c can never be EOF, because you have erroneously declared it a
char. It should be an int.
fprintf(fout, "%c", c);
if (c != '\n')
seq[j] = c;
j++;
if (j % 100 == 0)
printf("%c", seq[j]);
}
fprintf(fout, "\n\n");
j = 0;
i++;


You fail to close fin1 before attempting to attach it to another
file.
}

fclose(fin);
fclose(fin1);
fclose(fout);
return 0;
}

The printf statements for me to check my code.

When I try to open 2 files, the first file is read in fine, but the
second file is incomplete. Over 600 characters are not read, and the
program hangs.

The amount of loss (after causing undefined behaviour) leads me to
suspect that your system has INT_MAX set at 32767. If so, you will
need to use long to ensure 32 bit ability.
 
B

Ben Bacarisse

Hi all,
I'm having programs reading from files.
Below is my code:

The hang is almost certainly because 'c' should be an int. fgetc
returns int so it can signal EOF. See the FAQ (http://c-faq.com/).

I will not a couple of other things but I think most have now been
covered.
#include <stdio.h>
#include <stdlib.h>

#define MAX_FILE 100 // maximum length of file name
#define MAX_SEQ 20000 // maximum length of sequence
#define N 2 // total number of sequences

int main(void)
{
FILE *fin, *fin1, *fout;
char input[MAX_FILE+1], seq[N][MAX_SEQ+1], c;

int c; and use FILENAME_MAX.
int size[N], i = 0, j = 0;

fin = fopen("files.txt", "r");
fout = fopen("output.txt", "w");

Check these!
while (fscanf(fin, "%s", input) != EOF)

Danger! Danger! There are pre-processor tricks you can use to get the
correct size into a scanf %s format, but it is probably better to use fgets.
{
fin1 = fopen(input, "r");
printf("%s\n", input);
fscanf(fin1, "%d ", &size);
printf("%d\n", size);
while ((c = fgetc(fin1)) != EOF)
{
fprintf(fout, "%c", c);
if (c != '\n')
seq[j] = c;


It is always best (unless you know it is safe) to check that you
indexes are in range.
j++;
if (j % 100 == 0)
printf("%c", seq[j]);
}
fprintf(fout, "\n\n");
j = 0;
i++;
}

fclose(fin);
fclose(fin1);
fclose(fout);
return 0;
}

The printf statements for me to check my code.

When I try to open 2 files, the first file is read in fine, but the
second file is incomplete. Over 600 characters are not read, and the
program hangs.


see above!
 
K

Keith Thompson

CBFalconer said:
c can never be EOF, because you have erroneously declared it a
char. It should be an int.
[...]

c can compare equal to EOF if plain char happens to be signed. In
that case, the code will *probably* work "correctly"; fgetc() will
eventually return EOF, and the test will work as intended.

It can fail badly if plain char is unsigned, and it can terminate
early if plain char is signed, and the file happens to contain a
character whose value matches EOF (typically EOF is -1 and char is 8
bits, so a character '\xff' in the input file would trigger this).

But rather than spending any time considering how the code can fail,
the OP should fix the bug by declarsing c as int. If the program
continues to misbehave in the same way, he'll have narrowed down the
problem to the rest of the program; if not, he'll have fixed one bug.
 
K

Kelsey Bjarnason

[snips]

#define MAX_FILE 100 // maximum length of file name
#define MAX_SEQ 20000 // maximum length of sequence
#define N 2 // total number of sequences

int main(void)
{
FILE *fin, *fin1, *fout;
char input[MAX_FILE+1], seq[N][MAX_SEQ+1], c;
Thjis line could cause problems, seq is too big to so safely on the
stack.

What stack? Could you kindly show the part of the C standard which
defines "stack" or requires auto variables to be created on the stack?
 
M

Malcolm McLean

Kelsey Bjarnason said:
What stack? Could you kindly show the part of the C standard which
defines "stack" or requires auto variables to be created on the stack?
Oh deary me. There's useful pedantry, and then there's the sort that just
tries to be clever.
 
K

Kelsey Bjarnason

Oh deary me. There's useful pedantry, and then there's the sort that just
tries to be clever.

Indeed. Useful pedantry says that since you're using C, and C has no
concept of a stack, that to discuss "the stack" is meaningless at best in
the context.

So, since you seem to think there's something wrong with this, I ask
again, could you kindly show the part of the C standard which defines
"stack" or requires auto variables to be created on the stack?

Or perhaps you weren't aware there are actually machines which don't use
stacks? There are - which is probably why C doesn't require stacks.
 
O

Old Wolf

Or perhaps you weren't aware there are actually machines which don't use
stacks? There are - which is probably why C doesn't require stacks.

I don't see how you can implement calling functions
and returning, without a stack of some sort. Any
structure that achieves the effect of pushing values
in and popping them off again could reasonably be
called a stack.
 
K

Keith Thompson

Old Wolf said:
I don't see how you can implement calling functions
and returning, without a stack of some sort. Any
structure that achieves the effect of pushing values
in and popping them off again could reasonably be
called a stack.

Yes, you need a stack *of some sort* (though a program needn't
actually use a stack if the compiler can prove that none of its
functions are called recursively).

But the term "stack" is commonly used in two distinct senses, as I
discussed at some length elsethread.

I understand that there are real world implementations in which the
memory required for a function's local automatically allocated objects
(plus bookkeeping information) is allocated as if by calling malloc()
when the function is called; the ordering in memory of what you might
call "stack frames" is unspecified. (I initially wrote that they're
allocated from the "heap", but that's equally ambiguous.) This is
certainly a "stack" in the sense of a fundamental data structure; it's
not a "stack" in the commonly used sense of a CPU-supported region of
memory addressed by a dedicated "stack pointer" register.

Of course no portable C program can tell the difference.

And this whole discussion would have been unnecessary if we'd been
clear about the distinction between the two meanings of "stack", or if
we'd avoided using the term in the first place.
 

Ask a Question

Want to reply to this thread or ask your own question?

You'll need to choose a username for the site, which only take a couple of moments. After that, you can post your question and our members will help you out.

Ask a Question

Members online

Forum statistics

Threads
474,432
Messages
2,571,681
Members
48,796
Latest member
Greg L.

Latest Threads

Top